glxA [2019-09-04 10:15:16]

glyoxalase I

locus: BSU_38370

pI: 4.43

mw: 14.29 kDa

protein length: 126 aa

gene length: 381 bp

function: detoxification of methylglyoxal

product: glyoxalase I

essential: no

synonyms: ipa-18r,ywbC

Genomic Context

categories

• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]

Gene

Coordinates: 3,937,135 3,937,515

Phenotypes of a mutant

• increased sensitivity to methylglyoxal [Pubmed|24330391]

The protein

Catalyzed reaction/ biological activity

• methylglyoxal + BSH - S-lactoyl-bacillithiol (BSH) [Pubmed|24330391]

Protein family

• glyoxalase I family (with [protein|F02D4AFF60ADDDC5F5B85A3ACCA3AF803560B91E|YraH] and [protein|0A244A61A9A484F0BF083C918AE5A2C6A3F8157E|GlxB], according to UniProt)

Structure

• [PDB|1F9Z] (from E. coli, 35% identity) [pubmed|10913283]

Expression and Regulation

Operons

• genes: [gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]
  description: [Pubmed|9353933]

Biological materials

Mutant

• MGNA-B221 (ywbC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1220 NBRP B. subtilis, Japan]
• BKE38370 ([gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCTCCTCCTCGTAA, downstream forward: _UP4_TAAAAATAAAGAACGTACAT
• BKK38370 ([gene|54E05955FF1732F434A0FAB08967573B8DD3ADD2|glxA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCTCCTCCTCGTAA, downstream forward: _UP4_TAAAAATAAAGAACGTACAT

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab

References

• 9353933,24330391,10913283